Pan troglodytes (chimpanzee): 751916 Help Entry 751916            miRNA     T01005                                  Symbol MIR204 Name (RefSeq) ptr-miR-204   KO K17166   microRNA 204 Organism ptr  Pan troglodytes (chimpanzee) Brite KEGG Orthology (KO) [BR:ptr00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ptr04147]     751916 (MIR204)   09184 RNA family    03100 Non-coding RNAs [BR:ptr03100]     751916 (MIR204) Exosome [BR:ptr04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    751916 (MIR204) Non-coding RNAs [BR:ptr03100]  Other eukaryotic RNA   Micro RNA    751916 (MIR204) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  751916 miRBase:  MI0002838 LinkDB All DBs Position 11:complement(61298775..61298884) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt ttccctttgtcatcctatgcct

DBGET integrated database retrieval system