Raphanus sativus (radish): 130501845
Help
Entry
130501845 ncRNA
T06014
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
rsz
Raphanus sativus (radish)
Pathway
rsz03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
rsz00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
130501845
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
rsz03041
]
130501845
09184 RNA family
03100 Non-coding RNAs [BR:
rsz03100
]
130501845
Spliceosome [BR:
rsz03041
]
Splicing related RNAs
130501845
Non-coding RNAs [BR:
rsz03100
]
Small nuclear RNA
Sm-class snRNA
130501845
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Other DBs
NCBI-GeneID:
130501845
LinkDB
All DBs
Position
Unknown
NT seq
118 nt
NT seq
+upstream
nt +downstream
nt
agccatgtggtgaatacagagcgaactattctttcgccttttactaaagaataccgtgtg
ttctccacgcttagtggcatacgcttatttttggaaggttccgcattcgtgtgggccc
DBGET
integrated database retrieval system