Sylvia atricapilla (blackcap): 136366317 Help Entry 136366317         CDS       T10263                                  Name (RefSeq) metallothionein-2   KO K14739   metallothionein 1/2 Organism sati  Sylvia atricapilla (blackcap) Brite Messenger RNA biogenesis [BR:sati03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      136366317 Mitochondrial biogenesis [BR:sati03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     136366317 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  136366317 NCBI-ProteinID:  XP_066183400 LinkDB All DBs Position 12:complement(8607670..8608750) Genome browser AA seq 63 aa AA seqDB search MDPQDCTCAAGDSCSCAGSCKCKNCRCQSCRKSCCSCCPASCSNCAKGCVCKEPTSNKCS CCH NT seq 192 nt NT seq  +upstreamnt  +downstreamnt atggacccccaggactgcacgtgtgccgccggtgactcctgctcctgcgccgggtcctgc aagtgcaagaactgccgctgccagagctgccgcaagagctgctgctcctgctgccccgcg agctgcagcaactgcgccaagggctgcgtgtgcaaggagccgaccagcaacaagtgcagc tgctgccactga

DBGET integrated database retrieval system