Spinacia oleracea (spinach): 130464772
Help
Entry
130464772 ncRNA
T05137
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
soe
Spinacia oleracea (spinach)
Pathway
soe03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
soe00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
130464772
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
soe03041
]
130464772
09184 RNA family
03100 Non-coding RNAs [BR:
soe03100
]
130464772
Spliceosome [BR:
soe03041
]
Splicing related RNAs
130464772
Non-coding RNAs [BR:
soe03100
]
Small nuclear RNA
Sm-class snRNA
130464772
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Other DBs
NCBI-GeneID:
130464772
LinkDB
All DBs
Position
6:complement(15847478..15847595)
Genome browser
NT seq
118 nt
NT seq
+upstream
nt +downstream
nt
agtcatgcagtgagcacaacagagcgaactattcttttgccttttactaaagtataagtg
tgctcactgcattaagtggcacacgtttatttttggaaggagttccttaaaggagctt
DBGET
integrated database retrieval system