Thermogladius calderae: TCELL_1336 Help Entry TCELL_1336        CDS       T02127                                  Name (GenBank) Lipoate-protein ligase A   KO K03800   lipoate---protein ligase [EC:6.3.1.20] Organism thg  Thermogladius calderae Pathway thg00785   Lipoic acid metabolism thg01100   Metabolic pathways thg01240   Biosynthesis of cofactors Brite KEGG Orthology (KO) [BR:thg00001]  09100 Metabolism   09108 Metabolism of cofactors and vitamins    00785 Lipoic acid metabolism     TCELL_1336 Enzymes [BR:thg01000]  6. Ligases   6.3  Forming carbon-nitrogen bonds    6.3.1  Acid-D-ammonia (or amine) ligases (amide synthases)     6.3.1.20  lipoate---protein ligase      TCELL_1336 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Lip_prot_lig_C Motif Other DBs NCBI-ProteinID:  AFK51758 UniProt:  I3TG70 LinkDB All DBs Position 1269760..1270059 Genome browser AA seq 99 aa AA seqDB search MRIGVYEHKARKGLIRVSLKIVEGVIEEATITGDFFIYPEDALFELESTLRGTKASWAEV SSKLDEFFSRGVELAGSTPEDFKTALKKALVEAGVHGEA NT seq 300 nt NT seq  +upstreamnt  +downstreamnt ttgaggataggcgtatacgagcacaaggctagaaaggggctgattagagtcagcttaaag atcgtagagggagtgatcgaagaagcgaccattacaggcgacttctttatataccccgag gacgccttgttcgagctggagtctacactcagggggactaaggcgtcttgggcggaggtc tcgtctaagctagacgagttcttcagccggggtgtagagctggcgggctcgacgcccgag gacttcaagactgctttgaagaaggctcttgtggaggccggtgtacatggggaggcttag

DBGET integrated database retrieval system