Trichoplusia ni (cabbage looper): 113493615
Help
Entry
113493615 ncRNA
T05757
Name
(RefSeq) U5 spliceosomal RNA
KO
K14279
U5 spliceosomal RNA
Organism
tnl
Trichoplusia ni (cabbage looper)
Pathway
tnl03040
Spliceosome
Brite
KEGG Orthology (KO) [BR:
tnl00001
]
09120 Genetic Information Processing
09121 Transcription
03040 Spliceosome
113493615
09180 Brite Hierarchies
09182 Protein families: genetic information processing
03041 Spliceosome [BR:
tnl03041
]
113493615
09184 RNA family
03100 Non-coding RNAs [BR:
tnl03100
]
113493615
Spliceosome [BR:
tnl03041
]
Splicing related RNAs
113493615
Non-coding RNAs [BR:
tnl03100
]
Small nuclear RNA
Sm-class snRNA
113493615
BRITE hierarchy
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Other DBs
NCBI-GeneID:
113493615
LinkDB
All DBs
Position
4:12468147..12468263
Genome browser
NT seq
117 nt
NT seq
+upstream
nt +downstream
nt
gaactctatttttcttttaaaacgcagaagtatttcgcctttcactaaagacttccgtgg
attggaacactcaaatgagttctatattttttgacaactctactgcggtattgcatg
DBGET
integrated database retrieval system