Tupaia chinensis (Chinese tree shrew): 104796281 Help Entry 104796281         miRNA     T02978                                  Symbol MIR98, tch-mir-98 Name (RefSeq) microRNA 98   KO K16980   microRNA let-7 Organism tup  Tupaia chinensis (Chinese tree shrew) Pathway tup05206   MicroRNAs in cancer tup05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:tup00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104796281 (MIR98)    05207 Chemical carcinogenesis - receptor activation     104796281 (MIR98)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tup04147]     104796281 (MIR98)   09184 RNA family    03100 Non-coding RNAs [BR:tup03100]     104796281 (MIR98) Exosome [BR:tup04147]  Exosomal RNA   Exosomal RNA of breast milk    104796281 (MIR98)   Exosomal RNA of saliva    104796281 (MIR98)   Exosomal RNA of ovarian cancer cells    104796281 (MIR98)   Exosomal RNA of renal carcinoma cells    104796281 (MIR98)   Exosomal RNA of other cancer cells    104796281 (MIR98) Non-coding RNAs [BR:tup03100]  Other eukaryotic RNA   Micro RNA    104796281 (MIR98) BRITE hierarchy SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  104796281 miRBase:  MI0031233 LinkDB All DBs Position Un NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgaggtagtaagttgtattgtt

DBGET integrated database retrieval system