KEGG   Homo sapiens (human): 6066
Entry
6066              ncRNA     T01001                                 
Symbol
RNU2-1, RNU2, U2
Name
(RefSeq) RNA, U2 small nuclear 1
  KO
K14277  U2 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    6066 (RNU2-1)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    6066 (RNU2-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    6066 (RNU2-1)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  6066 (RNU2-1)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   6066 (RNU2-1)
SSDB
Other DBs
NCBI-GeneID: 6066
OMIM: 180690
HGNC: 10142
Ensembl: ENSG00000274585
LinkDB
Position
17:complement(43233790..43233977)
NT seq 188 nt   +upstreamnt  +downstreamnt
atcgcttctcggccttttggctaagatcaagtgtagtatctgttcttatcagtttaatat
ctgatacgtcctctatccgaggacaatatattaaatggatttttggagcagggagatgga
ataggagcttgctccgtccactccacgcatcgacctggtattgcagtacctccaggaacg
gtgcaccc

DBGET integrated database retrieval system