Parus major (Great Tit): 107215360 Help Entry 107215360         CDS       T04864                                  Symbol POLE4 Name (RefSeq) DNA polymerase epsilon subunit 4   KO K03506   DNA polymerase epsilon subunit 4 [EC:2.7.7.7] Organism pmaj  Parus major (Great Tit) Pathway pmaj03030   DNA replication pmaj03410   Base excision repair pmaj03420   Nucleotide excision repair Brite KEGG Orthology (KO) [BR:pmaj00001]  09120 Genetic Information Processing   09124 Replication and repair    03030 DNA replication     107215360 (POLE4)    03410 Base excision repair     107215360 (POLE4)    03420 Nucleotide excision repair     107215360 (POLE4)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:pmaj03032]     107215360 (POLE4)    03400 DNA repair and recombination proteins [BR:pmaj03400]     107215360 (POLE4) Enzymes [BR:pmaj01000]  2. Transferases   2.7  Transferring phosphorus-containing groups    2.7.7  Nucleotidyltransferases     2.7.7.7  DNA-directed DNA polymerase      107215360 (POLE4) DNA replication proteins [BR:pmaj03032]  Eukaryotic type   DNA Replication Elongation Factors    DNA polymerase epsilon complex     107215360 (POLE4) DNA repair and recombination proteins [BR:pmaj03400]  Eukaryotic type   SSBR (single strand breaks repair)    BER (base exicision repair)     Long Patch-BER factors      DNA polymerase epsilon complex       107215360 (POLE4) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CBFD_NFYB_HMF Histone CENP-T_C TAF TFIID-31kDa SlpA CENP-S Motif Other DBs NCBI-GeneID:  107215360 NCBI-ProteinID:  XP_015506955 LinkDB All DBs Position 28:complement(589146..591271) Genome browser AA seq 93 aa AA seqDB search AAGAGPQGLGPARLARLPLARVKALVKADPDVTLASQEAVFVLARATELFVETIAKDAYV YAQQGKRKTLQRKDLDNAIEAIDEFAFLEGTLD NT seq 282 nt NT seq  +upstreamnt  +downstreamnt gcggcgggcgcggggccgcagggcctgggtccggcccggctggcccggctaccgctggcg cgggtgaaggcgctggtgaaggcggacccggacgtcaccctggccagccaggaggccgtg ttcgtgctggcgcgggccacggagctgtttgttgaaaccatagccaaagatgcttatgtg tatgcccagcaaggaaaaaggaaaaccctgcaaagaaaagacctggataatgccattgaa gctattgatgaatttgcttttttggaaggtactttggactga

DBGET integrated database retrieval system