KEGG   Homo sapiens (human): 26831
Entry
26831             ncRNA     T01001                                 
Symbol
RNU5A-1, RNU5, RNU5A, RNU5C, U5A, U5B1
Name
(RefSeq) RNA, U5A small nuclear 1
  KO
K14279  U5 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    26831 (RNU5A-1)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    26831 (RNU5A-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    26831 (RNU5A-1)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  26831 (RNU5A-1)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   26831 (RNU5A-1)
SSDB
Other DBs
NCBI-GeneID: 26831
OMIM: 180691
HGNC: 10211
Ensembl: ENSG00000199568
LinkDB
Position
15:65296051..65296167
NT seq 117 nt   +upstreamnt  +downstreamnt
atactctggtttctcttcagatcgcataaatctttcgccttttactaaagatttccgtgg
agaggaacaactctgagtcttaacccaattttttgaggccttgctttggcaaggcta

DBGET integrated database retrieval system