KEGG   VARIANT: 7015v1Help
Entry
7015v1                      Variant                                

Name
TERT overexpression
Gene
TERT  telomerase reverse transcriptase [KO:K11126]
Organism
hsa_var Human gene variants (Homo sapiens)
Variation
promoter mutation C228T
Variation
promoter mutation C250T
Variation
promoter mutation C228A
Variation
promoter mutation C229A
Network
nt06232  Telomerase activity
nt06261  Gastric cancer
nt06263  Hepatocellular carcinoma
  Element
N00240  TERT-overexpression to telomerase activity
Reference
  Authors
Killela PJ, Reitman ZJ, Jiao Y, Bettegowda C, Agrawal N, Diaz LA Jr, Friedman AH, Friedman H, Gallia GL, Giovanella BC, Grollman AP, He TC, He Y, Hruban RH, Jallo GI, Mandahl N, Meeker AK, Mertens F, Netto GJ, Rasheed BA, Riggins GJ, Rosenquist TA, Schiffman M, Shih IeM, Theodorescu D, Torbenson MS, Velculescu VE, Wang TL, Wentzensen N, Wood LD, Zhang M, McLendon RE, Bigner DD, Kinzler KW, Vogelstein B, Papadopoulos N, Yan H
  Title
TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal.
  Journal
Proc Natl Acad Sci U S A 110:6021-6 (2013)
DOI:10.1073/pnas.1303607110
Reference
  Authors
Cevik D, Yildiz G, Ozturk M
  Title
Common telomerase reverse transcriptase promoter mutations in hepatocellular carcinomas from different geographical locations.
  Journal
World J Gastroenterol 21:311-7 (2015)
DOI:10.3748/wjg.v21.i1.311
Reference
  Authors
Pezzuto F, Buonaguro L, Buonaguro FM, Tornesello ML
  Title
Frequency and geographic distribution of TERT promoter mutations in primary hepatocellular carcinoma.
  Journal
Infect Agent Cancer 12:27 (2017)
DOI:10.1186/s13027-017-0138-5
Reference
  Authors
Huang DS, Wang Z, He XJ, Diplas BH, Yang R, Killela PJ, Meng Q, Ye ZY, Wang W, Jiang XT, Xu L, He XL, Zhao ZS, Xu WJ, Wang HJ, Ma YY, Xia YJ, Li L, Zhang RX, Jin T, Zhao ZK, Xu J, Yu S, Wu F, Liang J, Wang S, Jiao Y, Yan H, Tao HQ
  Title
Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation.
  Journal
Eur J Cancer 51:969-76 (2015)
DOI:10.1016/j.ejca.2015.03.010
LinkDB All DBs

KEGG   Homo sapiens (human): 7012Help
Entry
7012              ncRNA     T01001                                 

Gene name
TERC, DKCA1, PFBMFT2, SCARNA19, TR, TRC3, hTR
Definition
(RefSeq) telomerase RNA component
  KO
K22183  telomerase RNA component
Organism
hsa  Homo sapiens (human)
Pathway
hsa05200  Pathways in cancer
hsa05225  Hepatocellular carcinoma
hsa05226  Gastric cancer
Network
nt06232  Telomerase activity
nt06261  Gastric cancer
nt06263  Hepatocellular carcinoma
  Element
N00239  Telomerase activity
N00240  TERT-overexpression to telomerase activity
Disease
H00507  Dyskeratosis congenita
H01132  Aplastic anemia
H01299  Idiopathic pulmonary fibrosis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05200 Pathways in cancer
    7012 (TERC)
  09162 Cancer: specific types
   05225 Hepatocellular carcinoma
    7012 (TERC)
   05226 Gastric cancer
    7012 (TERC)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    7012 (TERC)
Non-coding RNAs [BR:hsa03100]
 Other RNA
  Unclassified
   7012 (TERC)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 7012
OMIM: 602322
HGNC: 11727
Ensembl: ENSG00000277925
LinkDB All DBs
Position
3q26.2
NT seq 451 nt NT seq  +upstreamnt  +downstreamnt
gggttgcggagggtgggcctgggaggggtggtggccattttttgtctaaccctaactgag
aagggcgtaggcgccgtgcttttgctccccgcgcgctgtttttctcgctgactttcagcg
ggcggaaaagcctcggcctgccgccttccaccgttcattctagagcaaacaaaaaatgtc
agctgctggcccgttcgcccctcccggggacctgcggcgggtcgcctgcccagcccccga
accccgcctggaggccgcggtcggcccggggcttctccggaggcacccactgccaccgcg
aagagttgggctctgtcagccgcgggtctctcgggggcgagggcgaggttcaggcctttc
aggccgcaggaagaggaacggagcgagtccccgcgcgcggcgcgattccctgagctgtgg
gacgtgcacccaggactcggctcacacatgc

DBGET integrated database retrieval system